디렉토리에 여러 개의 파일을 열 때 "No such file"이 표시되지만 하나의 파일 만 열면 오류가 없습니다.

Question

디렉토리에서 하나의 파일을 열고 다음 코드를 실행할 수 있습니다. 그러나 디렉토리 내의 여러 파일에 동일한 코드를 사용하려고하면 파일이 존재하지 않는다는 오류가 발생합니다.

파일 이름을 올바르게 지정했는지, 올바른 형식인지, 현재 작업 디렉토리에 있는지, 올바르게 참조되어 있는지 확인하려고했습니다.

많은 사람들이 이전에이 오류가 있었음을 알고 비슷한 질문을 게시했지만 어떤 도움도 받으실 수 있습니다.

근무 코드 : 여기

#!/usr/bin/perl 

use warnings; 
use strict; 
use diagnostics; 

use List::Util qw(min max); 

my $RawSequence = loadSequence("LDTest.fasta"); 
my $windowSize = 38; 
my $stepSize = 1; 
my %hash; 
my $s1; 
my $s2; 
my $dist; 

for (my $windowStart = 0; $windowStart <= 140; $windowStart += $stepSize) { 

    my $s1 = substr($$RawSequence, $windowStart, $windowSize); 
    my $s2 = 'CGGAGCTTTACGAGCCGTAGCCCAAACAGTTAATGTAG'; 
      # the 28 nt forward primer after the barcode plus the first 10 nt of the mtDNA dequence 

    my $dist = levdist($s1, $s2); 

    $hash{$dist} = $s1; 

    #print "Distance between '$s1' and '$s2' is $dist\n"; 

    sub levdist { 
     my ($seq1, $seq2) = (@_)[ 0, 1 ]; 

     my $l1 = length($s1); 
     my $l2 = length($s2); 
     my @s1 = split '', $seq1; 
     my @s2 = split '', $seq2; 
     my $distances; 

     for (my $i = 0; $i <= $l1; $i++) { 
      $distances->[$i]->[0] = $i; 
     } 

     for (my $j = 0; $j <= $l2; $j++) { 
      $distances->[0]->[$j] = $j; 
     } 

     for (my $i = 1; $i <= $l1; $i++) { 

      for (my $j = 1; $j <= $l2; $j++) { 
       my $cost; 

       if ($s1[ $i - 1 ] eq $s2[ $j - 1 ]) { 
        $cost = 0; 
       } 
       else { 
        $cost = 1; 
       } 

       $distances->[$i]->[$j] = minimum(
        $distances->[ $i - 1 ]->[ $j - 1 ] + $cost, 
        $distances->[$i]->[ $j - 1 ] + 1, 
        $distances->[ $i - 1 ]->[$j] + 1, 
       ); 
      } 
     } 

     my $min_distance = $distances->[$l1]->[$l2]; 

     for (my $i = 0; $i <= $l1; $i++) { 
      $min_distance = minimum($min_distance, $distances->[$i]->[$l2]); 
     } 

     for (my $j = 0; $j <= $l2; $j++) { 
      $min_distance = minimum($min_distance, $distances->[$l1]->[$j]); 
     } 

     return $min_distance; 
    } 
} 

sub minimum { 
    my $min = shift @_; 

    foreach (@_) { 
     if ($_ < $min) { 
      $min = $_; 
     } 
    } 

    return $min; 
} 

sub loadSequence { 
    my ($sequenceFile) = @_; 
    my $sequence = ""; 

    unless (open(FASTA, "<", $sequenceFile)) { 
     die $!; 
    } 

    while (<FASTA>) { 
     my $line = $_; 
     chomp($line); 

     if ($line !~ /^>/) { 
      $sequence .= $line; #if the line doesn't start with > it is the sequence 
     } 
    } 

    return \$sequence; 
} 

my @keys = sort { $a <=> $b } keys %hash; 
my $BestMatch = $hash{ keys [0] }; 

if ($keys[0] < 8) { 
    $$RawSequence =~ s/\Q$BestMatch\E/CGGAGCTTTACGAGCCGTAGCCCAAACAGTTAATGTAG/g; 
    print ">|Forward|Distance_of_Best_Match: $keys[0] |Sequence_of_Best_Match: $BestMatch", "\n", 
      "$$RawSequence", "\n"; 
} 

내 비 작동 코드의 축약 버전입니다. 내가 포함되지 않았다 변경하지 않은 것들 :

헤더 및 전역 :

이

my $dir   = ("/Users/roblogan/Documents/FakeFastaFiles"); 
my @ArrayofFiles = glob "$dir/*.fasta"; 

foreach my $file (@ArrayofFiles) { 

    open(my $Opened, $file) or die "can't open file: $!"; 

    while (my $OpenedFile = <$Opened>) { 

     my $RawSequence = loadSequence($OpenedFile); 

     for (...) { 

      ...; 

      print 
        ">|Forward|Distance_of_Best_Match: $keys[0] |Sequence_of_Best_Match: $BestMatch", 
        "\n", "$$RawSequence", "\n"; 
     } 
    } 
} 

정확한 오류는 다음과 같습니다

Uncaught exception from user code: 
     No such file or directory at ./levenshtein_for_directory.pl line 93, <$Opened> line 1. 
    main::loadSequence('{\rtf1\ansi\ansicpg1252\cocoartf1404\cocoasubrtf470\x{a}') called at ./levenshtein_for_directory.pl line 22 

93 :

 89 sub loadSequence{ 
    90   my ($sequenceFile) = @_; 
    91   my $sequence = ""; 
    92   unless (open(FASTA, "<", $sequenceFile)){ 
    93     die $!; 
    94   } 

라인 22 :

 18   foreach my $file (@ArrayofFiles) { 
    19    open (my $Opened, $file) or die "can't open file: $!"; 
    20    while (my $OpenedFile = <$Opened>) { 
    21 
    22     my $RawSequence = loadSequence($OpenedFile); 
    23 

Answer 1

나는 방금 "파스타 파일"이 정착 된 용어라는 것을 알았습니다. 그것을 인식하지 못했고 이전에 그들은 일부 파일이이고 파일 이름 등을 포함한다고 생각했습니다. @zdim이 이미 말했듯이,이 파일을 두 번 열었습니다.

다음 코드는 FASTA 파일 목록 (파일 이름 만)을 가져오고 각각의 파일 이름을 사용하여 loadSequence을 호출합니다. 이 서브 루틴은 주어진 파일을 열고 none-^> 행을 하나의 큰 행에 연결하고이를 리턴합니다.

# input: the NAME of a FASTA file 
# return: all sequences in that file as one very long string 
sub loadSequence 
{ 
    my ($fasta_filename) = @_; 
    my $sequence = ""; 
    open(my $fasta_fh, '<', $fasta_filename) or die "Cannot open $fasta_filename: $!\n"; 
    while (my $line = <$fasta_fh>) { 
     chomp($line); 
     if ($line !~ /^>/) { 
      $sequence .= $line; #if the line doesn't start with > it is the sequence 
     } 
    } 
    close($fasta_fh); 
    return $sequence; 
} 

# ... 

my $dir = '/Users/roblogan/Documents/FakeFastaFiles'; 
my @ArrayofFiles = glob "$dir/*.fasta"; 
foreach my $filename (@ArrayofFiles) { 
    my $RawSequence = loadSequence($filename); 
    # ... 
} 

Answer 2

파일을 두 번 열려고하는 것 같습니다. 라인

my @ArrayofFiles = glob "$dir/*.fasta"; 

당신에게 파일 목록을 제공합니다. 그런 다음

다음을 차례로 수행하십시오. 파일을 차례로 반복하고, 각각을 열고, 한 줄을 읽은 다음 줄을 loadSequence()에 전송합니다. 이미 열려있는 파일에서 선이고 -

그러나, 그 함수에서 다시

sub loadSequence{ 
    my ($sequenceFile) = @_; 
    my $sequence = ""; 
    unless (open(FASTA, "<", $sequenceFile)){ 
    # ... 

기능의 $sequenceFile 변수 $OpenedFile로 함수에 전달되는 파일을 열려고 파일 이름이 아니라 읽을 수 있습니다. 코드의 세부 사항에 대해서는 확실하지 않지만 표시되는 오류는이 코드와 일치하는 것으로 보입니다.

그것은 당신이 참으로 readdir를 수행하면 파일에 액세스해야 할 것 opendir와 함께, 당신에게 파일의 목록을 제공하는의 glob를 혼동되어있을 수 있습니다. $OpenedFile (예 : $line)의 이름을 바꾸어보세요.